traits introductionlibrary("traits")
Get trait data for Willow (Salix spp.)
(salix <- betydb_search("Salix Vcmax"))
#> Source: local data frame [14 x 30]
#>
#> access_level author citation_id citation_year city commonname
#> 1 4 Merilo 430 2005 Saare basket willow
#> 2 4 Merilo 430 2005 Saare basket willow
#> 3 4 Merilo 430 2005 Saare basket willow
#> 4 4 Merilo 430 2005 Saare basket willow
#> 5 4 Wullschleger 51 1993 NA willow
#> 6 4 Merilo 430 2005 Saare basket willow
#> 7 4 Merilo 430 2005 Saare basket willow
#> 8 4 Merilo 430 2005 Saare basket willow
#> 9 4 Merilo 430 2005 Saare basket willow
#> 10 4 Merilo 430 2005 Saare willow
#> 11 4 Merilo 430 2005 Saare willow
#> 12 4 Merilo 430 2005 Saare willow
#> 13 4 Merilo 430 2005 Saare willow
#> 14 4 Wang 381 2010 NA
#> Variables not shown: cultivar_id (int), date (chr), dateloc (chr), genus
#> (chr), id (int), lat (dbl), lon (dbl), mean (chr), month (dbl), n (int),
#> notes (chr), result_type (chr), scientificname (chr), site_id (int),
#> sitename (chr), species_id (int), stat (chr), statname (chr), trait
#> (chr), trait_description (chr), treatment (chr), treatment_id (int),
#> units (chr), year (dbl)
# equivalent:
# (out <- betydb_search("willow"))
Summarise data from the output data.frame
library("dplyr")
salix %>%
group_by(scientificname, trait) %>%
mutate(.mean = as.numeric(mean)) %>%
summarise(mean = round(mean(.mean, na.rm = TRUE), 2),
min = round(min(.mean, na.rm = TRUE), 2),
max = round(max(.mean, na.rm = TRUE), 2),
n = length(n))
#> Source: local data frame [4 x 6]
#> Groups: scientificname
#>
#> scientificname trait mean min max n
#> 1 Salix Vcmax 65.00 65.00 65.00 1
#> 2 Salix dasyclados Vcmax 46.08 34.30 56.68 4
#> 3 Salix sachalinensis × miyabeana Vcmax 79.28 79.28 79.28 1
#> 4 Salix viminalis Vcmax 43.04 19.99 61.29 8
Get sequences by id
ncbi_byid(ids = "360040093", format = "fasta")
#> taxon
#> 1 Eristalis transversa
#> gene_desc
#> 1 Eristalis transversa voucher CNC:Diptera:102013 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
#> gi_no acc_no length
#> 1 360040093 JN991986.1 658
#> sequence
#> 1 TACTTTATATTTTGTATTTGGAACATGAGCGGGTATAGTAGGAACTTCATTAAGAATTTTAATTCGAGCTGAATTAGGTCATCCAGGTGCATTAATTGGTGATGATCAAATTTATAATGTTATTGTAACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCACTTATATTAGGAGCTCCAGATATAGCATTCCCTCGAATAAATAATATAAGTTTCTGATTATTACCTCCTTCTTTAACTCTATTATTAGTAAGAAGTATAGTAGAAAATGGGGCTGGAACAGGATGAACAGTTTATCCTCCATTATCAAGTAATATTGCACATGGAGGAGCCTCAGTTGATTTAGCAATTTTTTCACTTCACTTATCAGGAATATCATCTATTTTAGGTGCAGTAAATTTTATTACAACAGTTATTAATATACGATCAACAGGAATTACTTATGATCGTATACCTTTATTTGTTTGATCTGTTGCTATTACAGCTTTATTATTATTATTATCATTACCAGTACTAGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCATTCTTTGATCCAGCAGGAGGAGGAGACCCTATCCTGTACCAACACTTATTC
Get sequences searching by taxonomic name
out <- ncbi_searcher(taxa = "Umbra limi", seqrange = "1:2000")
head(out)
#> taxon length
#> 1 Umbra limi 412
#> 2 Umbra limi 315
#> 3 Umbra limi 200
#> 4 Umbra limi 333
#> 5 Umbra limi 242
#> 6 Umbra limi 386
#> gene_desc
#> 1 tRNA-Glu gene, partial sequence; and cytochrome b (CYTB) gene, partial cds; mitochondrial
#> 2 16S ribosomal RNA gene, partial sequence; mitochondrial
#> 3 16S ribosomal RNA gene, partial sequence; mitochondrial
#> 4 16S ribosomal RNA gene, partial sequence; mitochondrial
#> 5 12S ribosomal RNA gene, partial sequence; mitochondrial
#> 6 12S ribosomal RNA gene, partial sequence; mitochondrial
#> acc_no gi_no
#> 1 KM523322 725542537
#> 2 KM435059 725542420
#> 3 KM434991 725542361
#> 4 KM282516 725542294
#> 5 KM282453 725542240
#> 6 KM273864 725542182
sp <- c("Carpobrotus edulis", "Rosmarinus officinalis")
g_invasive(sp)
#> species
#> 1 Carpobrotus edulis
#> 2 Rosmarinus officinalis
#> status
#> 1 Carpobrotus edulis is a mat-forming succulent native to South Africa which is invasive primarily in coastal habitats in many parts of the world. It was often introduced as an ornamental plant or used for planting along roadsides, from which it has spread to become invasive. Its main impacts are smothering, reduced regeneration of native flora and changes to soil pH and nutrient regimes.; (succulent); Common Names: balsamo, Cape fig, figue marine, freeway iceplant, ghaukum, ghoenavy, highway ice plant, higo del Cabo, higo marino, Hottentosvy, hottentot fig, Hottentottenfeige, iceplant, ikhambi-lamabulawo, Kaapsevy, patata frita, perdevy, pigface, rankvy, sea fig, sour fig, suurvy, umgongozi, vyerank; Synonyms: Mesembryanthemum edule L., Mesembryanthemum edulis
#> 2 Not in GISD
Or as simplified output
g_invasive(sp, simplify = TRUE)
#> species status
#> 1 Carpobrotus edulis Invasive
#> 2 Rosmarinus officinalis Not in GISD
eol_invasive_('Brassica oleracea', dataset = 'gisd')
#> searched_name name eol_object_id db
#> 1 Brassica oleracea Brassica oleracea NaN gisd
Another example, with more species, and from
eol_invasive_(c('Lymantria dispar','Cygnus olor','Hydrilla verticillata','Pinus concolor'),
dataset = 'i3n')
#> searched_name name eol_object_id
#> 1 Lymantria dispar Lymantria dispar NaN
#> 2 Cygnus olor Cygnus olor (Gmelin 1789) 913227
#> 3 Hydrilla verticillata Hydrilla verticillata (L. f.) Royle 1088921
#> 4 Pinus concolor Pinus concolor NaN
#> db
#> 1 i3n
#> 2 i3n
#> 3 i3n
#> 4 i3n
Searching for Mesoplodon bidens, page id 328566
res <- traitbank(trait = 328566)
res$graph %>%
select(dwc.measurementtype..id, dwc.measurementtype.rdfs.label.en, dwc.measurementvalue) %>%
filter(!is.na(dwc.measurementvalue))
#> Source: local data frame [59 x 3]
#>
#> dwc.measurementtype..id dwc.measurementtype.rdfs.label.en
#> 1 http://iucn.org/population_trend population trend
#> 2 http://rs.tdwg.org/dwc/terms/habitat habitat
#> 3 http://rs.tdwg.org/dwc/terms/habitat habitat
#> 4 http://rs.tdwg.org/dwc/terms/habitat habitat
#> 5 http://rs.tdwg.org/dwc/terms/habitat habitat
#> 6 http://rs.tdwg.org/dwc/terms/habitat habitat
#> 7 http://rs.tdwg.org/dwc/terms/habitat habitat
#> 8 http://rs.tdwg.org/dwc/terms/habitat habitat
#> 9 http://rs.tdwg.org/dwc/terms/habitat habitat
#> 10 http://rs.tdwg.org/dwc/terms/habitat habitat
#> .. ... ...
#> Variables not shown: dwc.measurementvalue (chr)
Get the species list and their ids
coral_species()
#> Source: local data frame [1,547 x 2]
#>
#> name id
#> 1 Acanthastrea brevis 3
#> 2 Acanthastrea echinata 4
#> 3 Acanthastrea hemprichi 6
#> 4 Acanthastrea ishigakiensis 8
#> 5 Acanthastrea regularis 12
#> 6 Acanthastrea rotundoflora 13
#> 7 Acanthastrea subechinata 14
#> 8 Acropora abrolhosensis 16
#> 9 Acropora abrotanoides 17
#> 10 Acropora aculeus 18
#> .. ... ..
Get data by taxon
coral_taxa(80)
#> Source: local data frame [3,084 x 25]
#>
#> observation_id access user_id specie_id specie_name location_id
#> 1 109330 1 2 80 Acropora hyacinthus 1
#> 2 88793 1 14 80 Acropora hyacinthus 0
#> 3 115791 1 10 80 Acropora hyacinthus 1
#> 4 115792 1 10 80 Acropora hyacinthus 1
#> 5 5694 1 2 80 Acropora hyacinthus 1
#> 6 5696 1 2 80 Acropora hyacinthus 1
#> 7 5741 1 1 80 Acropora hyacinthus 1
#> 8 5751 1 1 80 Acropora hyacinthus 1
#> 9 5787 1 1 80 Acropora hyacinthus 1
#> 10 5766 1 1 80 Acropora hyacinthus 1
#> .. ... ... ... ... ... ...
#> Variables not shown: location_name (chr), latitude (dbl), longitude (dbl),
#> resource_id (int), resource_secondary_id (int), measurement_id (int),
#> trait_id (int), trait_name (chr), standard_id (int), standard_unit
#> (chr), methodology_id (int), methodology_name (chr), value (chr),
#> value_type (chr), precision (lgl), precision_type (lgl), precision_upper
#> (lgl), replicates (lgl), notes (lgl)
Get data by trait
coral_traits(105)
#> Source: local data frame [1,491 x 25]
#>
#> observation_id access user_id specie_id specie_name
#> 1 155 1 8 3 Acanthastrea brevis
#> 2 236 1 1 4 Acanthastrea echinata
#> 3 364 1 8 6 Acanthastrea hemprichi
#> 4 495 1 1 8 Acanthastrea ishigakiensis
#> 5 738 1 8 12 Acanthastrea regularis
#> 6 804 1 8 13 Acanthastrea rotundoflora
#> 7 865 1 1 14 Acanthastrea subechinata
#> 8 981 1 8 16 Acropora abrolhosensis
#> 9 1061 1 8 17 Acropora abrotanoides
#> 10 90549 1 8 18 Acropora aculeus
#> .. ... ... ... ... ...
#> Variables not shown: location_id (int), location_name (chr), latitude
#> (lgl), longitude (lgl), resource_id (int), resource_secondary_id (lgl),
#> measurement_id (int), trait_id (int), trait_name (chr), standard_id
#> (int), standard_unit (chr), methodology_id (lgl), methodology_name
#> (lgl), value (chr), value_type (chr), precision (lgl), precision_type
#> (lgl), precision_upper (lgl), replicates (lgl), notes (chr)
sp <- c("Lavandula stoechas", "Carpobrotus edulis", "Rhododendron ponticum",
"Alkanna lutea", "Anchusa arvensis")
sapply(sp, fe_native, simplify = FALSE)
#> $`Lavandula stoechas`
#> $`Lavandula stoechas`$native
#> [1] "Islas_Baleares" "Corse" "Kriti" "France"
#> [5] "Greece" "Spain" "Italy" "Portugal"
#> [9] "Sardegna" "Sicilia" "Turkey"
#>
#> $`Lavandula stoechas`$exotic
#> [1] NA
#>
#> $`Lavandula stoechas`$status_doubtful
#> [1] NA
#>
#> $`Lavandula stoechas`$occurrence_doubtful
#> [1] NA
#>
#> $`Lavandula stoechas`$extinct
#> [1] NA
#>
#>
#> $`Carpobrotus edulis`
#> $`Carpobrotus edulis`$native
#> [1] NA
#>
#> $`Carpobrotus edulis`$exotic
#> [1] "Albania" "Azores" "Belgium" "Islas_Baleares"
#> [5] "Britain" "Corse" "France" "Greece"
#> [9] "Ireland" "Spain" "Italy" "Portugal"
#> [13] "Sicilia"
#>
#> $`Carpobrotus edulis`$status_doubtful
#> [1] NA
#>
#> $`Carpobrotus edulis`$occurrence_doubtful
#> [1] NA
#>
#> $`Carpobrotus edulis`$extinct
#> [1] NA
#>
#>
#> $`Rhododendron ponticum`
#> $`Rhododendron ponticum`$native
#> [1] "Bulgaria" "Spain" "Portugal" "Turkey"
#>
#> $`Rhododendron ponticum`$exotic
#> [1] "Belgium" "Britain" "France" "Ireland"
#>
#> $`Rhododendron ponticum`$status_doubtful
#> [1] NA
#>
#> $`Rhododendron ponticum`$occurrence_doubtful
#> [1] NA
#>
#> $`Rhododendron ponticum`$extinct
#> [1] NA
#>
#>
#> $`Alkanna lutea`
#> $`Alkanna lutea`$native
#> [1] "Islas_Baleares" "Corse" "France" "Spain"
#> [5] "Italy" "Sardegna"
#>
#> $`Alkanna lutea`$exotic
#> [1] NA
#>
#> $`Alkanna lutea`$status_doubtful
#> [1] NA
#>
#> $`Alkanna lutea`$occurrence_doubtful
#> [1] "Portugal"
#>
#> $`Alkanna lutea`$extinct
#> [1] NA
#>
#>
#> $`Anchusa arvensis`
#> $`Anchusa arvensis`$native
#> [1] "Albania" "Austria"
#> [3] "Belgium" "Islas_Baleares"
#> [5] "Britain" "Bulgaria"
#> [7] "Corse" "Czechoslovakia"
#> [9] "Denmark" "Finland"
#> [11] "France" "Germany"
#> [13] "Greece" "Switzerland"
#> [15] "Netherlands" "Spain"
#> [17] "Hungary" "Italy"
#> [19] "Jugoslavia" "Portugal"
#> [21] "Norway" "Poland"
#> [23] "Romania" "USSR"
#> [25] "USSR_Northern_Division" "USSR_Baltic_Division"
#> [27] "USSR_Central_Division" "USSR_South_western"
#> [29] "USSR_Krym" "USSRSouth_eastern_Division"
#> [31] "Sicilia" "Sweden"
#>
#> $`Anchusa arvensis`$exotic
#> [1] "Faroer"
#>
#> $`Anchusa arvensis`$status_doubtful
#> [1] "Ireland" "Sardegna"
#>
#> $`Anchusa arvensis`$occurrence_doubtful
#> [1] NA
#>
#> $`Anchusa arvensis`$extinct
#> [1] NA
Habitat data
birdlife_habitat(22721692)
#> id Habitat (level 1) Habitat (level 2) Importance
#> 1 22721692 Forest Subtropical/Tropical Dry suitable
#> 2 22721692 Forest Subtropical/Tropical Moist Montane major
#> 3 22721692 Forest Temperate suitable
#> 4 22721692 Shrubland Subtropical/Tropical High Altitude suitable
#> Occurrence
#> 1 breeding
#> 2 non-breeding
#> 3 breeding
#> 4 breeding
Threats data
birdlife_threats(22721692)
#> id threat1
#> 1 22721692 Agriculture & aquaculture
#> 2 22721692 Agriculture & aquaculture
#> 3 22721692 Biological resource use
#> 4 22721692 Energy production & mining
#> 5 22721692 Invasive and other problematic species, genes & diseases
#> 6 22721692 Residential & commercial development
#> threat2
#> 1 Annual & perennial non-timber crops / Agro-industry farming
#> 2 Annual & perennial non-timber crops / Small-holder farming
#> 3 Logging & wood harvesting / Unintentional effects: (subsistence/small scale) [harvest]
#> 4 Mining & quarrying
#> 5 Problematic native species/diseases
#> 6 Housing & urban areas
#> stresses timing scope
#> 1 Ecosystem degradation, Ecosystem conversion Ongoing Majority (50-90%)
#> 2 Ecosystem degradation, Ecosystem conversion Ongoing Majority (50-90%)
#> 3 Ecosystem degradation Ongoing Majority (50-90%)
#> 4 Ecosystem degradation, Ecosystem conversion Ongoing Majority (50-90%)
#> 5 Species mortality Ongoing Minority (
#> 6 Ecosystem degradation, Ecosystem conversion Ongoing Minority (
#> severity impact
#> 1 Slow, Significant Decline Medium Impact: 6
#> 2 Slow, Significant Decline Medium Impact: 6
#> 3 Slow, Significant Decline Medium Impact: 6
#> 4 Slow, Significant Decline Medium Impact: 6
#> 5 No decline Low Impact: 4
#> 6 Slow, Significant Decline Low Impact: 5
sp <- c("Lavandula stoechas", "Carpobrotus edulis", "Rhododendron ponticum",
"Alkanna lutea", "Anchusa arvensis")
Native in the continental USA?
sapply(sp, is_native, where = "Continental US", region = "america")
#> Lavandula stoechas Carpobrotus edulis Rhododendron ponticum
#> "Introduced" "Introduced" "species not in itis"
#> Alkanna lutea Anchusa arvensis
#> "species not in itis" "Introduced"
Native on Islas Baleares?
sapply(sp, is_native, where = "Islas_Baleares", region = "europe")
#> Lavandula stoechas Carpobrotus edulis Rhododendron ponticum
#> "Native" "Introduced" "Not found"
#> Alkanna lutea Anchusa arvensis
#> "Native" "Native"