traits introductionlibrary("traits")
Get trait data for Willow (Salix spp.)
(salix <- betydb_search("Salix Vcmax"))
#> # A tibble: 14 x 36
#> access_level author checked citation_id citation_year city
#> * <int> <chr> <int> <int> <int> <chr>
#> 1 4 Wullschleger 1 51 1993 <NA>
#> 2 4 Wang 1 381 2010 <NA>
#> 3 4 Merilo 1 430 2005 Saare
#> 4 4 Merilo 1 430 2005 Saare
#> 5 4 Merilo 1 430 2005 Saare
#> 6 4 Merilo 1 430 2005 Saare
#> 7 4 Merilo 1 430 2005 Saare
#> 8 4 Merilo 1 430 2005 Saare
#> 9 4 Merilo 1 430 2005 Saare
#> 10 4 Merilo 1 430 2005 Saare
#> 11 4 Merilo 1 430 2005 Saare
#> 12 4 Merilo 1 430 2005 Saare
#> 13 4 Merilo 1 430 2005 Saare
#> 14 4 Merilo 1 430 2005 Saare
#> # ... with 30 more variables: commonname <chr>, cultivar <chr>,
#> # cultivar_id <int>, date <chr>, dateloc <chr>, entity <lgl>,
#> # genus <chr>, id <int>, lat <dbl>, lon <dbl>, mean <dbl>,
#> # method_name <lgl>, month <int>, n <int>, notes <chr>, raw_date <chr>,
#> # result_type <chr>, scientificname <chr>, site_id <int>,
#> # sitename <chr>, species_id <int>, stat <dbl>, statname <chr>,
#> # time <chr>, trait <chr>, trait_description <chr>, treatment <chr>,
#> # treatment_id <int>, units <chr>, year <int>
# equivalent:
# (out <- betydb_search("willow"))
Summarise data from the output data.frame
library("dplyr")
salix %>%
group_by(scientificname, trait) %>%
mutate(.mean = as.numeric(mean)) %>%
summarise(mean = round(mean(.mean, na.rm = TRUE), 2),
min = round(min(.mean, na.rm = TRUE), 2),
max = round(max(.mean, na.rm = TRUE), 2),
n = length(n))
#> # A tibble: 4 x 6
#> # Groups: scientificname [?]
#> scientificname trait mean min max n
#> <chr> <chr> <dbl> <dbl> <dbl> <int>
#> 1 Salix Vcmax 65.00 65.00 65.00 1
#> 2 Salix dasyclados Vcmax 46.08 34.30 56.68 4
#> 3 Salix sachalinensis × miyabeana Vcmax 79.28 79.28 79.28 1
#> 4 Salix viminalis Vcmax 43.04 19.99 61.29 8
Get sequences by id
ncbi_byid(ids = "360040093")
#> taxon
#> 1 Eristalis transversa
#> gene_desc
#> 1 Eristalis transversa voucher CNC:Diptera:102013 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
#> gi_no acc_no length
#> 1 360040093 JN991986.1 658
#> sequence
#> 1 tactttatattttgtatttggaacatgagcgggtatagtaggaacttcattaagaattttaattcgagctgaattaggtcatccaggtgcattaattggtgatgatcaaatttataatgttattgtaacagctcatgcttttgttataattttttttatagtaatacctattataattggaggatttggaaattgattagtaccacttatattaggagctccagatatagcattccctcgaataaataatataagtttctgattattacctccttctttaactctattattagtaagaagtatagtagaaaatggggctggaacaggatgaacagtttatcctccattatcaagtaatattgcacatggaggagcctcagttgatttagcaattttttcacttcacttatcaggaatatcatctattttaggtgcagtaaattttattacaacagttattaatatacgatcaacaggaattacttatgatcgtatacctttatttgtttgatctgttgctattacagctttattattattattatcattaccagtactagcaggagctattacaatattattaactgatcgaaatttaaatacatcattctttgatccagcaggaggaggagaccctatcctgtaccaacacttattc
Get sequences searching by taxonomic name
out <- ncbi_searcher(taxa = "Umbra limi", seqrange = "1:2000")
head(out)
#> taxon length
#> 1 Umbra limi 761
#> 2 Umbra limi 765
#> 3 Umbra limi 764
#> 4 Umbra limi 743
#> 5 Umbra limi 758
#> 6 Umbra limi 653
#> gene_desc
#> 1 Umbra limi voucher NXG2012264 rhodopsin (Rho) gene, partial cds
#> 2 Umbra limi voucher NXG201250 rhodopsin (Rho) gene, partial cds
#> 3 Umbra limi voucher NXG2012183 rhodopsin (Rho) gene, partial cds
#> 4 Umbra limi voucher NXG201252 rhodopsin (Rho) gene, partial cds
#> 5 Umbra limi voucher NXG2012231 rhodopsin (Rho) gene, partial cds
#> 6 Umbra limi voucher NXG201250 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
#> acc_no gi_no
#> 1 KX146134 1049488959
#> 2 KX146015 1049488721
#> 3 KX145969 1049488629
#> 4 KX145777 1049488245
#> 5 KX145759 1049488209
#> 6 KX145415 1049487591
Searching for Balaenoptera musculus (blue whale), page id 328574
res <- traitbank(328574)
res$graph %>%
select(`dwc:measurementtype`) %>%
filter(!is.na(`dwc:measurementtype`))
#> # A tibble: 181 x 1
#> `dwc:measurementtype`
#> <chr>
#> 1 http://eol.org/schema/terms/MineralCompositionOfMilk
#> 2 http://eol.org/schema/terms/MineralCompositionOfMilk
#> 3 http://eol.org/schema/terms/MineralCompositionOfMilk
#> 4 http://eol.org/schema/terms/MineralCompositionOfMilk
#> 5 http://eol.org/schema/terms/MineralCompositionOfMilk
#> 6 http://eol.org/schema/terms/MineralCompositionOfMilk
#> 7 http://eol.org/schema/terms/MineralCompositionOfMilk
#> 8 http://eol.org/schema/terms/MineralCompositionOfMilk
#> 9 http://eol.org/schema/terms/MineralCompositionOfMilk
#> 10 http://eol.org/schema/terms/MineralCompositionOfMilk
#> # ... with 171 more rows
Get the species list and their ids
coral_species()
#> # A tibble: 1,548 x 2
#> name id
#> <chr> <chr>
#> 1 Acanthastrea brevis 3
#> 2 Acanthastrea echinata 4
#> 3 Acanthastrea hemprichi 6
#> 4 Acanthastrea ishigakiensis 8
#> 5 Acanthastrea regularis 12
#> 6 Acanthastrea rotundoflora 13
#> 7 Acanthastrea subechinata 14
#> 8 Acropora abrolhosensis 16
#> 9 Acropora abrotanoides 17
#> 10 Acropora aculeus 18
#> # ... with 1,538 more rows
Get data by taxon
coral_taxa(80)
#> # A tibble: 3,540 x 25
#> observation_id access user_id specie_id specie_name location_id
#> <int> <int> <int> <int> <chr> <int>
#> 1 157133 1 10 80 Acropora hyacinthus 1
#> 2 156961 1 14 80 Acropora hyacinthus 409
#> 3 5781 1 1 80 Acropora hyacinthus 1
#> 4 156610 1 2 80 Acropora hyacinthus 500
#> 5 158118 1 10 80 Acropora hyacinthus 409
#> 6 119211 1 49 80 Acropora hyacinthus 1
#> 7 158211 1 10 80 Acropora hyacinthus 413
#> 8 90294 1 15 80 Acropora hyacinthus 341
#> 9 90294 1 15 80 Acropora hyacinthus 341
#> 10 90294 1 15 80 Acropora hyacinthus 341
#> # ... with 3,530 more rows, and 19 more variables: location_name <chr>,
#> # latitude <dbl>, longitude <dbl>, resource_id <int>,
#> # resource_secondary_id <int>, measurement_id <int>, trait_id <int>,
#> # trait_name <chr>, standard_id <int>, standard_unit <chr>,
#> # methodology_id <int>, methodology_name <chr>, value <chr>,
#> # value_type <chr>, precision <dbl>, precision_type <chr>,
#> # precision_upper <dbl>, replicates <int>, notes <chr>
Get data by trait
coral_traits(105)
#> # A tibble: 0 x 25
#> # ... with 25 variables: observation_id <lgl>, access <lgl>,
#> # user_id <lgl>, specie_id <lgl>, specie_name <lgl>, location_id <lgl>,
#> # location_name <lgl>, latitude <lgl>, longitude <lgl>,
#> # resource_id <lgl>, resource_secondary_id <lgl>, measurement_id <lgl>,
#> # trait_id <lgl>, trait_name <lgl>, standard_id <lgl>,
#> # standard_unit <lgl>, methodology_id <lgl>, methodology_name <lgl>,
#> # value <lgl>, value_type <lgl>, precision <lgl>, precision_type <lgl>,
#> # precision_upper <lgl>, replicates <lgl>, notes <lgl>
Habitat data
birdlife_habitat(22721692)
#> id Habitat (level 1) Habitat (level 2) Importance
#> 1 22721692 Forest Subtropical/Tropical Dry suitable
#> 2 22721692 Forest Subtropical/Tropical Moist Montane major
#> 3 22721692 Forest Temperate suitable
#> 4 22721692 Shrubland Subtropical/Tropical High Altitude suitable
#> Occurrence
#> 1 breeding
#> 2 non-breeding
#> 3 breeding
#> 4 breeding
Threats data
birdlife_threats(22721692)
#> id threat1
#> 1 22721692 Agriculture & aquaculture
#> 2 22721692 Agriculture & aquaculture
#> 3 22721692 Biological resource use
#> 4 22721692 Energy production & mining
#> 5 22721692 Invasive and other problematic species, genes & diseases
#> 6 22721692 Residential & commercial development
#> threat2
#> 1 Annual & perennial non-timber crops
#> 2 Annual & perennial non-timber crops
#> 3 Logging & wood harvesting
#> 4 Mining & quarrying
#> 5 Problematic native species/diseases
#> 6 Housing & urban areas
#> stresses
#> 1 Ecosystem degradation, Ecosystem conversion
#> 2 Ecosystem degradation, Ecosystem conversion
#> 3 Ecosystem degradation
#> 4 Ecosystem degradation, Ecosystem conversion
#> 5 Species mortality
#> 6 Ecosystem degradation, Ecosystem conversion
#> timing
#> 1 Agriculture & aquaculture
#> 2 Agriculture & aquaculture
#> 3 Biological resource use
#> 4 Energy production & mining
#> 5 Invasive and other problematic species, genes & diseases
#> 6 Residential & commercial development
#> scope severity impact
#> 1 Annual & perennial non-timber crops Ongoing Ongoing
#> 2 Annual & perennial non-timber crops Ongoing Ongoing
#> 3 Logging & wood harvesting Ongoing Ongoing
#> 4 Mining & quarrying Ongoing Ongoing
#> 5 Problematic native species/diseases Ongoing Ongoing
#> 6 Housing & urban areas Ongoing Ongoing